Fourth Unit

Here are questions on Homeostasis:

1. What is positive feedback? Give an example. Are positive feedback mechanisms usually involved in maintaining homeostasis? Explain.
2. Explain how the surface area to volume ratio of an organism has an effect on heat dissipation or heat retention.
3. What cooling mechanisms are activated when the hypothalmus senses a body temperature above the set point?
4. What mechanisms are activated when body temperature falls below the set point?

Endocrine System Questions

5. Summarize the functional relationship between the hypothalamus and the anterior pituitary gland.

6. Besides the hormones they secrete, what distinguishes the anterior and posterior pituitary glands?

7.

Sketch the specific hormonal control between the hypothalamus, anterior pituitary and an endocrine organ, and include the negative feedback pathway. see figure for an example…

8. What effect does parathyroid hormone have on the body?

9. What hormones are secreted by the adrenal medulla, and what are their functions?

10. What are the two types of hormones secreted by the adrenal cortex, and what are their functions?

11. On what organ do estradiol and progesterone act?

12. The thyroid gland produces two hormones, triiodothyronine (T3) and thyroxine (T4). Explain how a lack of iodine in the diet may result in goiter, (an enlarged thyroid gland).

13. Determine the main functions of each of the hormones in the table below.

 

 

 

 

14. How does the adrenal gland signaled by the hypothalamus to respond to i) short-term stress, ii) long-term stress.

Nervous System Questions

15. What are the labeled parts to the neuron in the image? 

16. At resting potential, what is the principal cation inside the cell? and, outside the cell?

17. At resting potential, which side of the membrane has a negative charge?

18. Label the components of the action potential, the channels, and ions in the diagram below.

19. Identify the components of the chemical synapse following the depolarization of the synaptic terminal in the diagram below. 

20. Bonus test question on function of thalmus, corpus callosum, cerebrum, medulla oblongata, cerebellum.

21. What is saltatory conduction?

Questions on the Immune System

22. How is the great diversity of B and T cells produced?

23. What prevents B cells and T cells from reacting against the body’s own molecules?

24. Describe clonal selection.

25. What is immunological memory?

26. Activated helper T cells release cytokines. What do cytokines do to promote an immune response?

27. What does a cytotoxic T cell attached to an infected body cell release?

28. Label the components in the diagram below that shows a helper T cell being activated by interaction with an antigen presenting cell, and the helper T cell’s central role in activation of humoral and cell-mediated immunity.

29. Diagram the initiation of a specific immune response from the APC (antigen-presenting cell) to the activation of helper T cells, subsequent activation of naive B-cells and/or naive cytotoxic T-cells, including the MHC presentation of antigen and the BCR and TCR (cell receptors CD4 and CD8), clonal expansion of activated cells,  cells’ specific actions to immobilize or destroy the invading pathogen, and finally the development of immunological memory.

30. What is the speed and immunological reactivity of a second exposure compared to the first exposure of an antigen.

 

 

Transcription and Translation (a.k.a. Protein Synthesis)

We studied how mRNA is made from a gene. We discussed the need for a promoter (a DNA sequence upstream of a gene) to signal where the RNA polymerase needs to bind. We also studied how RNA polymerase opens up the DNA gene segment to make an RNA transcript but also “zips” the DNA closed as the segment has finished being copied.

Eukaryotic mRNA transcripts have three modifications made before it can leave the nucleus to be translated into proteins by ribosomes in the cytoplasm. Ribosome are complexes of rRNA (ribosomal RNA) and catalytic proteins. These units allow for the interaction of mRNA with tRNAs as well as the polymerization of amino acids into a polypeptide chain from the order dictated in the mRNA copied for the genomic DNA.

Here are a few questions:

1. If the DNA template strand has the sequence 3′ CAAATTGGCTTATTACCGGATG 5′, what is the sequence of an RNA transcribed from it? What are the amino acid coded by this sequence? (remember that you need to consult a chart with the genetic code and that the first amino acid is ALWAYS methionine)
2. Spliceosomes (snRNPs) remove introns. They are protein and snRNA complexes that bind by complementary base pairing to the exon/intron boundary. What two catalytic functions do snRNPs perform to complete splicing?
3. What are the steps involved in initiating translation of a mature mRNA?
4. Explain the role of the three tRNA-binding sites in the large ribosomal subunit (P-site, A-site, and E-site).
5. How are tRNAs loaded with the correct amino acid?
6. In the diagram of polypeptide synthesis below, name the stages 1 to 4. Identify the components (a to l). This diagram does not include the initiation stage.

DNA Replication

 You have learned how duplicated chromosomes separate in mitosis in your first biology course. In this course, we cover the other side of the cell cycle when single-chromatid chromosomes are duplicated to become two-chromatid chromosomes.

To answer all questions, remember that nucleic acids are elongated by adding nucleotides to free 3’OH group of the deoxyribose sugar. So, you can assume that DNA polymerase adds nucleotides in the same manner.

Be sure to know what the following enzymes (and other proteins) are and when they act in relation to each other for both leading and lagging strands. Helicase, Primase, SSBPs, DNA Polymerase III, DNA Polymerase I, Topoisomerase, Ligase.

1. In the diagram below, give names to the labels. Include: leading strand, lagging strand, Okazaki fragment, DNA polymerase III, DNA polymerase I, DNA ligase, helicase, single-stranded binding proteins, primase, RNA primer, 5′ end and 3′ end of parental DNA.
2. For each of the labels in figure below, indicate which represents the 5’OH end of the single DNA strand, at which would the next nucleotide be added, which indicates a phosphodiester bond formed by DNA polymerase?
3. For the same figure what is the complementary base sequence for this strand (include direction).
4. The DNA of an organism has thymine as 20% of its bases. What percentage of its bases would be guanine?
5. How does DNA synthesis along the lagging strand differ from that on the leading strand?
6. For the last Okazaki fragment formed on the lagging strand of a linear DNA molecule, explain how this results in the shortening of the chromosome. Outline how telomerase acts to mitigate the shortening of linear chromosomes.

Cell Signalling

Cells communicate with each other in multicellular organisms to coordinate functions and development. Unicellular organisms communicate to each other to signal local population density or to collectively produce a protective biofilm.

Three stages characterize cell signalling: signal reception, signal transduction, and cell response.

Our classes have focused on three different types of receptors in the plasma membrane: G protein-linked receptors, receptor tyrosine kinases, and ligand-gated ion channels. There are also specific cytoplasmic receptors that bind hydrophobic signals that diffuse through the plasma membrane.

A signal transduction pathway is the series of steps involved in the conversion of a signal received by the cell at its surface to the cell’s response. These pathways are multistep (relay) cascades of molecular interactions for a couple of reasons: 1- a few signal molecules can be amplified by the transduction pathway to get a large cellular response, and 2- each step in the transduction pathway provides the opportunity to regulate or coordinate the cellular response. Transduction pathways can be mediated by 1) protein phosphorylation (protein kinases) and shut down by dephosphorylation (protein phosphatases) and, 2) secondary messengers such as cAMP, Ca2+, IP3 (Inositol Triphosphate) and DAG (diacylglycerol).

The cell may respond by activating transcription factors (which would regulate–turn on or off–specific genes). Or, cytoplasmic enzymes could be activated. As well, membrane protein channels could be opened or closed. And still, cell activity overall could be influenced to change to promote growth for example. Since each cell has a particular set of signal receptors, each of which have a particular set of relay proteins and a particular set of response proteins, then different cells can respond to different signals OR respond to the same signal in different ways. Also, signal transduction pathways within a single cell may “branch” causing more than one cellular response, OR two or more pathways may interact (“cross-talk”) to mediate a single response.

Try the following problems:

1. Explain why G protein-coupled (also called G protein-linked) receptor pathways shut down rapidly in the absence of a signal molecule.
2. Name the parts in the diagram of an activated receptor tyrosine kinase dimer.
3. What does a protein kinase do?
4. What does a protein phosphatase do?
5. What is a “phosphorylation cascade”?
6. Name the components in the following diagram depicting the steps in a signal transduction pathway that uses cAMP as a secondary messenger.
7. Fill in the blanks to review the G protein-coupled pathway that uses Ca2+ as a second messenger.A ______________ binds to a G protein-coupled receptor. An activated ______________ activates the enzyme phospholipase C, which cleaves a _______________ into DAG and ______________, which binds to and opens a ligand-gated channel, releasing ______________ from the ________________.
8. How does each of the following inactivation mechanisms discontinue a cell’s response to a signal and maintain the cell’s ability to respond to fresh signals?
   1. Reversible binding of signalling molecules
   2. GTPase activity of G protein
   3. Phosphodiesterase
   4. Protein phosphatases

Photosynthesis

Autotrophs are organisms that convert light energy to chemical energy through photosynthesis. In light-dependent reactions, ATP and NADPH are produced through photosystems of electron transport in the thylakoid inner membranes (where molecules of water are stripped to provide electrons to these ETC systems!), then in the light-independent reactions that ATP and NADPH are used to produce sugars from CO2 in the atmosphere! If we weren’t already so habituated to the facts of photosynthesis, it would seem like an impossible fantasy of science fiction.

Here are a few questions to help you test your understanding. Post your responses to the comments.

1. Use the following labels for the diagram below: NADPH, CO2, LIGHT, O2, ATP, SUGAR/CH2O, LIGHT REACTIONS IN THYLAKOID MEMBRANES, CALVIN CYCLE IN STROMA, H20 
2. Below is an image of an action spectrum (relative rates of photosynthesis under different wavelengths of light) and an absorption spectrum (the different wavelengths of light absorbed by chlorophylls a). Indicate which line (solid or dotted) represents the absorption spectrum and which represents the action spectrum of a plant performing photosynthesis. Why are these lines different?
3. How are the electron “holes” filled in chlorophyll P680+? and, P700+?
4. Specify the terms for the blanks of the diagram below. Which of these provide chemical energy and reducing power to the Calvin cycle?
5. Why is neither O2 nor NADPH generated by cyclic electron flow?
6. How is ATP produced by cyclic electron flow? (be specific by referring to elements of the ETC).
7. What does rubisco do?
8. Refer to the diagram below to answer these questions: What are the three phases (a, b, and c) of the Calvin cycle? What are the key molecules (d to o)?
9. What is the cause of photorespiration and what are the consequences?

Cellular Respiration and Fermentation

Glycolysis and cellular respiration are catabolic pathways that release chemical potential energy of glucose in the readily usable form of ATP. In the cytosol, glucose is broken down into 3-carbon pyruvate molecules which either enters the mitochondria if O2 is available, or stays in the cytosol to undergo fermentation which makes NAD+ (a glycolysidic substrate) available for the process of glycolysis to continue.

Here are a few questions to help test your understanding.

1. In the figure below: what are the three stages of cellular respiration (labels a, b, c)?
2. What do the arrows labeled d represent?
3. In the figure below: specify if ATP is produced by substrate-level phosphorylation OR oxidative phosphorylation (labels e, f, g).
4. In the reaction: C6H12O6 + 6 O2 → 6 CO2 + 6 H20, what becomes reduced and what becomes oxidized?
5. How many molecules of CO2 are generated for each molecule of acetyl-CoA introduced into the citric acid cycle?
6. Provide the correct terms for the labels of the diagram below. Grey balls represent carbon atoms.
7. What is the role of oxygen in cellular respiration?
8. Provide terms for the labels of the oxidative phosphorylation diagram below.
9. What are the numbers for the tally of ATP yield from the oxidation of one glucose molecule? Use the diagram below to add the tally from each of the processes.
10. Why does fermentation produce less ATP than cellular respiration?
11. At what point do fats enter the catabolic pathway? At what point do proteins enter the catabolic pathway?

Energy, Enzymes, and Metabolism

Metabolism includes all the reactions in an organism. Catabolic and anabolic pathways (series of reactions) intertwine to breakdown molecules (often the food we eat) to provide energy or to use energy to build up biomolecules.

Getting into bioenergetics a little more, we’ll need to understand those energy transformations. In particular, the concept of energy coupling of reactions, which then involves understanding how proteins work.

Try these questions. Publish your answers in the comments to one, some or all.

1. How would you label the three components (a, b, and c) of the ATP molecule in the image below?
2. In the image above, which bond(s) is/are likely to break? And, name the chemical mechanism by which this bond is broken.
3. Explain why this reaction releases so much energy.
4. In the figure illustrating an exergonic reaction below, indicate the correct labels for a-e.
5. Both ATP and ADP serve as regulators of enzyme activity. In catabolic pathways, which of these two molecules would you predict acts as an inhibitor? Which one acts as an activator?
6. Why are catabolic and anabolic pathways often coupled in a cell?
7. When a cell breaks down glucose, only about 34% of the energy is captured by ATP. According to the 2nd law of thermodynamics, what happens to the other 66% of the energy?
8. In reference to enzymes and substrates, what is meant by an “induced fit”?
9. When substance A was added to an enzyme reaction, product formation was decreased. The addition of more substrate did not increase product formation. What could substance A be?

 

Week of Introductions

Welcome to General Biology II at Vanier College.

The primary function of this website is to provide you with study questions and provide you with a open means to communicate solutions to given problems. This way, you can see where your classmates are at, and you can solve these questions as a group.

First Study Topic: Cell Membranes

1. If a eukaryotic cell has a diameter that is 10 times that of a bacterial cell, proportionally how much more surface area would the eukaryotic cell have? Proportionally how much more volume would it have?
2. In your own words, describe the molecular structure of the plasma membrane.
3. A solution of 1 molar (M) glucose is separated by a selectively permeable membrane from a solution of 0.2 M fructose and 0.7 M sucrose. The membrane is not permeable to the sugar molecules. Indicate which side initially has more free water molecules, and which side has fewer. What is the result in volumes (higher or lower) for sides A and B after osmosis has occurred?

4. The ratios of saturated to unsaturated phospholipids in an organism’s membranes can change in response to changes in environmental conditions. In warm environments, how would you expect the fatty acid tails of the membrane phospholipids of tropical plants to be different than those of fish living in cold waters? (HINT: consider how permeability and fluidity of a membrane that contains a low percentage of unsaturated phospholipids compare with those of a membrane that contains a high percentage of unsaturated phospholipids.)

5. Use your knowledge of how the concentration of solutions outside cells affects cell shape to explain why salting meat is an effective way to preserve it (and keep bacteria from rotting it).

6. Tough Question: How is cholesterol transported into human cells? Explain why cholesterol accumulates in the blood of individuals with the disease familial hypercholesterolemia?