Transcription and Translation (a.k.a. Protein Synthesis)

We studied how mRNA is made from a gene. We discussed the need for a promoter (a DNA sequence upstream of a gene) to signal where the RNA polymerase needs to bind. We also studied how RNA polymerase opens up the DNA gene segment to make an RNA transcript but also “zips” the DNA closed as the segment has finished being copied.

Eukaryotic mRNA transcripts have three modifications made before it can leave the nucleus to be translated into proteins by ribosomes in the cytoplasm. Ribosome are complexes of rRNA (ribosomal RNA) and catalytic proteins. These units allow for the interaction of mRNA with tRNAs as well as the polymerization of amino acids into a polypeptide chain from the order dictated in the mRNA copied for the genomic DNA.

Here are a few questions:

1. If the DNA template strand has the sequence 3′ CAAATTGGCTTATTACCGGATG 5′, what is the sequence of an RNA transcribed from it? What are the amino acid coded by this sequence? (remember that you need to consult a chart with the genetic code and that the first amino acid is ALWAYS methionine)
2. Spliceosomes (snRNPs) remove introns. They are protein and snRNA complexes that bind by complementary base pairing to the exon/intron boundary. What two catalytic functions do snRNPs perform to complete splicing?
3. What are the steps involved in initiating translation of a mature mRNA?
4. Explain the role of the three tRNA-binding sites in the large ribosomal subunit (P-site, A-site, and E-site).
5. How are tRNAs loaded with the correct amino acid?
6. In the diagram of polypeptide synthesis below, name the stages 1 to 4. Identify the components (a to l). This diagram does not include the initiation stage.

DNA Replication

 You have learned how duplicated chromosomes separate in mitosis in your first biology course. In this course, we cover the other side of the cell cycle when single-chromatid chromosomes are duplicated to become two-chromatid chromosomes.

To answer all questions, remember that nucleic acids are elongated by adding nucleotides to free 3’OH group of the deoxyribose sugar. So, you can assume that DNA polymerase adds nucleotides in the same manner.

Be sure to know what the following enzymes (and other proteins) are and when they act in relation to each other for both leading and lagging strands. Helicase, Primase, SSBPs, DNA Polymerase III, DNA Polymerase I, Topoisomerase, Ligase.

1. In the diagram below, give names to the labels. Include: leading strand, lagging strand, Okazaki fragment, DNA polymerase III, DNA polymerase I, DNA ligase, helicase, single-stranded binding proteins, primase, RNA primer, 5′ end and 3′ end of parental DNA.
2. For each of the labels in figure below, indicate which represents the 5’OH end of the single DNA strand, at which would the next nucleotide be added, which indicates a phosphodiester bond formed by DNA polymerase?
3. For the same figure what is the complementary base sequence for this strand (include direction).
4. The DNA of an organism has thymine as 20% of its bases. What percentage of its bases would be guanine?
5. How does DNA synthesis along the lagging strand differ from that on the leading strand?
6. For the last Okazaki fragment formed on the lagging strand of a linear DNA molecule, explain how this results in the shortening of the chromosome. Outline how telomerase acts to mitigate the shortening of linear chromosomes.

Cell Signalling

Cells communicate with each other in multicellular organisms to coordinate functions and development. Unicellular organisms communicate to each other to signal local population density or to collectively produce a protective biofilm.

Three stages characterize cell signalling: signal reception, signal transduction, and cell response.

Our classes have focused on three different types of receptors in the plasma membrane: G protein-linked receptors, receptor tyrosine kinases, and ligand-gated ion channels. There are also specific cytoplasmic receptors that bind hydrophobic signals that diffuse through the plasma membrane.

A signal transduction pathway is the series of steps involved in the conversion of a signal received by the cell at its surface to the cell’s response. These pathways are multistep (relay) cascades of molecular interactions for a couple of reasons: 1- a few signal molecules can be amplified by the transduction pathway to get a large cellular response, and 2- each step in the transduction pathway provides the opportunity to regulate or coordinate the cellular response. Transduction pathways can be mediated by 1) protein phosphorylation (protein kinases) and shut down by dephosphorylation (protein phosphatases) and, 2) secondary messengers such as cAMP, Ca2+, IP3 (Inositol Triphosphate) and DAG (diacylglycerol).

The cell may respond by activating transcription factors (which would regulate–turn on or off–specific genes). Or, cytoplasmic enzymes could be activated. As well, membrane protein channels could be opened or closed. And still, cell activity overall could be influenced to change to promote growth for example. Since each cell has a particular set of signal receptors, each of which have a particular set of relay proteins and a particular set of response proteins, then different cells can respond to different signals OR respond to the same signal in different ways. Also, signal transduction pathways within a single cell may “branch” causing more than one cellular response, OR two or more pathways may interact (“cross-talk”) to mediate a single response.

Try the following problems:

1. Explain why G protein-coupled (also called G protein-linked) receptor pathways shut down rapidly in the absence of a signal molecule.
2. Name the parts in the diagram of an activated receptor tyrosine kinase dimer.
3. What does a protein kinase do?
4. What does a protein phosphatase do?
5. What is a “phosphorylation cascade”?
6. Name the components in the following diagram depicting the steps in a signal transduction pathway that uses cAMP as a secondary messenger.
7. Fill in the blanks to review the G protein-coupled pathway that uses Ca2+ as a second messenger.A ______________ binds to a G protein-coupled receptor. An activated ______________ activates the enzyme phospholipase C, which cleaves a _______________ into DAG and ______________, which binds to and opens a ligand-gated channel, releasing ______________ from the ________________.
8. How does each of the following inactivation mechanisms discontinue a cell’s response to a signal and maintain the cell’s ability to respond to fresh signals?
   1. Reversible binding of signalling molecules
   2. GTPase activity of G protein
   3. Phosphodiesterase
   4. Protein phosphatases