We studied how mRNA is made from a gene. We discussed the need for a promoter (a DNA sequence upstream of a gene) to signal where the RNA polymerase needs to bind. We also studied how RNA polymerase opens up the DNA gene segment to make an RNA transcript but also “zips” the DNA closed as the segment has finished being copied.
Eukaryotic mRNA transcripts have three modifications made before it can leave the nucleus to be translated into proteins by ribosomes in the cytoplasm. Ribosome are complexes of rRNA (ribosomal RNA) and catalytic proteins. These units allow for the interaction of mRNA with tRNAs as well as the polymerization of amino acids into a polypeptide chain from the order dictated in the mRNA copied for the genomic DNA.
Here are a few questions:
- If the DNA template strand has the sequence 3′ CAAATTGGCTTATTACCGGATG 5′, what is the sequence of an RNA transcribed from it? What are the amino acid coded by this sequence? (remember that you need to consult a chart with the genetic code and that the first amino acid is ALWAYS methionine)
- Spliceosomes (snRNPs) remove introns. They are protein and snRNA complexes that bind by complementary base pairing to the exon/intron boundary. What two catalytic functions do snRNPs perform to complete splicing?
- What are the steps involved in initiating translation of a mature mRNA?
- Explain the role of the three tRNA-binding sites in the large ribosomal subunit (P-site, A-site, and E-site).
- How are tRNAs loaded with the correct amino acid?
- In the diagram of polypeptide synthesis below, name the stages 1 to 4. Identify the components (a to l). This diagram does not include the initiation stage.
HTK General Biology 2 
1. DNA 3′ CAAATTGGCTTATTACCGGATG 5′
RNA 5′ GUUUAACCGAAU/AUG/GCC/UAC 3′
amino acid: Met-Ala-Tyr
2.Breaking the phosphodiester bond between the exon and the intron and forming a bond between the two ends of the exons.
3. The small subunit of the ribosome attaches to the start codon of the mRNA, then the tRNA carrying methionine binds to the start codon too. The large subunit’s p-site binds to the tRNA to complete initiation.
4. p-site: catalyzes phophodiester bond between the amino acids in the growing polypeptide chain
a-site: entry of new tRNA
e-site: exit of tRNA
5. Aminoacyl-tRNA synthetase are the enzyme that load the correct amino acid on the correct tRNA with the aid of its high affinity for both compounds.
6. 1) tRNA enters the ribosome in the a-site
2) elongation of polypeptide
3) tRNA exits the ribosome
4) termination of translation
a) polypeptide chain
b) tRNA
c) large subunit of ribosome
d) a-site
e) small subunit of ribosome
f) mRNA
g) peptide bond
h) e-site
i) release factor
LikeLike